View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323_low_3 (Length: 233)
Name: NF4323_low_3
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 33612261 - 33612354
Alignment:
| Q |
17 |
aatatgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattgcaactatg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33612261 |
aatatgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattacaactatg |
33612354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 33612416 - 33612465
Alignment:
| Q |
172 |
caactttaatcataactatggttaaaaatttacatgtgaatgttgatgat |
221 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
33612416 |
caactttaatcatatctattgttaaaaatttacatgtgaatgtttatgat |
33612465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University