View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-15 (Length: 114)
Name: NF4324-Insertion-15
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-15 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 6e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 6e-56
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 3882422 - 3882535
Alignment:
| Q |
1 |
tctcggtcatctaatttgaaggaggttgatgtagcttgtctcaatctatgatggcttaatctaaggtattgtttgcctctcaaatgaatgtggattggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3882422 |
tctcggtcatctaatttgaaggaggttgatgtagcctgtctcaatctatgatggcttaatctaaggtattgtttgcctctcaaatgaatgtggattggtt |
3882521 |
T |
|
| Q |
101 |
tctgtcctcataac |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3882522 |
tctgtcctcataac |
3882535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 5e-35
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 3869023 - 3869121
Alignment:
| Q |
11 |
ctaatttgaaggaggttgatgtagcttgtctcaatctatgatggcttaatctaaggtattgtttgcctctcaaatgaatgtggattggtttctgtcctc |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
3869023 |
ctaatttgaaggaagttgatgtagcttgtctcaatctatgctggcttaatctaaggtattgttcgcccctcaaaagaatgtggattggtttctgacctc |
3869121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University