View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-19 (Length: 127)
Name: NF4324-Insertion-19
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 8404713 - 8404587
Alignment:
| Q |
1 |
atagtttcttccggtggcattttcggtacaaagataagtgacaccaaattgacccctccctagttcctttccaatactatagagtgtcttcatgtcaatg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404713 |
atagtttcttccagtggcattttcggtacaaagataagtgacaccaaattgacccctccctagttcctttccaatactatagagtgtcttcatgtcaatg |
8404614 |
T |
 |
| Q |
101 |
tatggccttcctaatattggttgatga |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8404613 |
tatggccttcctaatattggttgatga |
8404587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University