View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-22 (Length: 180)
Name: NF4324-Insertion-22
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 5060305 - 5060127
Alignment:
| Q |
1 |
taaccgagtcatattcatagtagaatttcagccaatgactaaannnnnnnagcaatttcttaagtaacgtttctgttaagtaacacatttgaatttttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5060305 |
taaccgagtcatattcatagtagaatttcagccaatgactaaattttttcagcaatttcttaagtaacgtttctgttaagtaacacatttgaatttttga |
5060206 |
T |
|
| Q |
101 |
aaaagagaaacgaacgaatcaaccctcccctctttagagatgattagttaacaac-aaaaagtcaaatatatgaatgcaag |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | || |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
5060205 |
aaaagagaaacgaacgaatcaaccctcccctcttca-tga-gattagttaacaacaaaaaagtcaaatatacgaatgcaag |
5060127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University