View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-23 (Length: 43)
Name: NF4324-Insertion-23
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 31; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 36
Target Start/End: Complemental strand, 37252197 - 37252167
Alignment:
| Q |
6 |
cacaaccaccgcagcaccagacccaatattt |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37252197 |
cacaaccaccgcagcaccagacccaatattt |
37252167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University