View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4324-Insertion-28 (Length: 146)

Name: NF4324-Insertion-28
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4324-Insertion-28
NF4324-Insertion-28
[»] chr8 (1 HSPs)
chr8 (4-143)||(13411488-13411627)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 4 - 143
Target Start/End: Complemental strand, 13411627 - 13411488
Alignment:
4 agaatcatcagcagcagcattattctacctctacaagttcagaaatggaaaccatgtttactaattcagaatctttctcagtgaaacaagaagaaaagga 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
13411627 agaatcatcagcagcagcattattctacctctacaagttcagaaatggaaacaatgtttactaattcagaatctttctcagtgaaacaagaagaaaagga 13411528  T
104 ccctttttcacatggaatacaatacaatgattactcttat 143  Q
    ||||||||||||||||||||||||||||||||||||||||    
13411527 ccctttttcacatggaatacaatacaatgattactcttat 13411488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University