View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-28 (Length: 146)
Name: NF4324-Insertion-28
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 4 - 143
Target Start/End: Complemental strand, 13411627 - 13411488
Alignment:
| Q |
4 |
agaatcatcagcagcagcattattctacctctacaagttcagaaatggaaaccatgtttactaattcagaatctttctcagtgaaacaagaagaaaagga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411627 |
agaatcatcagcagcagcattattctacctctacaagttcagaaatggaaacaatgtttactaattcagaatctttctcagtgaaacaagaagaaaagga |
13411528 |
T |
|
| Q |
104 |
ccctttttcacatggaatacaatacaatgattactcttat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411527 |
ccctttttcacatggaatacaatacaatgattactcttat |
13411488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University