View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-31 (Length: 193)
Name: NF4324-Insertion-31
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-31 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 193
Target Start/End: Complemental strand, 20363931 - 20363742
Alignment:
| Q |
3 |
agaaagtgaatattccaaacatgcaacagaacaccatacagtcgcaaccaagctcctctttcataaacattatcatccttcgatatccacacacgcatct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| || || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20363931 |
agaaagtgaatattccaaacatgcaacataatac-atacagtcgtaaccaagctcctctttcataaacattatcatccttcgatatccacacacgcacct |
20363833 |
T |
 |
| Q |
103 |
caaataacatgtcttctttttccataacaaatcagaaacacagtgtctcccctcattggtatcacacgaacatgttgaaatctagcatcaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20363832 |
caaataacatgtcttctttttccataacaaatcagaaacacagtgtctcccctcattggtatcacacgaacatgttgaaatctagcatcaa |
20363742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 109 - 185
Target Start/End: Complemental strand, 20371570 - 20371496
Alignment:
| Q |
109 |
acatgtcttctttttccataacaaatcagaaacacagtgtctcccctcattggtatcacacgaacatgttgaaatct |
185 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||| |||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
20371570 |
acatatcttgtttttccataacaaatcagaaacacaatgtctcccct--ttggtatcatgcaaacatgttgaaatct |
20371496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 20371666 - 20371625
Alignment:
| Q |
3 |
agaaagtgaatattccaaacatgcaacagaacaccatacagt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20371666 |
agaaagtgaatattccaaacatgcaacagaacaccatacagt |
20371625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University