View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-6 (Length: 173)
Name: NF4324-Insertion-6
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 6e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 13 - 173
Target Start/End: Original strand, 3414507 - 3414667
Alignment:
| Q |
13 |
agacagttatgcagaggatgaatattgtcgcgccacatcccaatgaggctacatcttgaatcggaaattcagatttgggggtagagatgcgcaatgacat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414507 |
agacagttatgcagaggatgaatattgtcgcgccacaacccaatgaggctacatcttgaatcggaaattcagatttgggggtagagatgcgcaatgacat |
3414606 |
T |
 |
| Q |
113 |
attaaggttaaagagaggtcatagagatatttggtttagatagctacacaaatttgtctct |
173 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3414607 |
attaaggttaaagagaggtcagagagatatttggtttagataactacacaaatttgtctct |
3414667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University