View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-7 (Length: 293)
Name: NF4324-Insertion-7
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 293
Target Start/End: Complemental strand, 36285272 - 36284976
Alignment:
| Q |
9 |
gagaatcaaataatcttcgttgtctaaatc-----caaggaaactttttagttgtctaaatcaaatccatcaccaaaaaanataccgaagttattttgga |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36285272 |
gagaatcaaataatctttgttgtctaaatcaaattcaaggaaactttttagttgtctaaatcaaatccatcaccaaaaaaaataccgaagttattttgga |
36285173 |
T |
|
| Q |
104 |
actaaccataaagtcaataacgaaccccttaacatctggctctatcaaaaaatattgtaccggagtccgaccccacaagaactt-------aacaccagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
36285172 |
actaaccataaagtcaataacgaaccccttgacatctggctctatcaaaaaatattgtaccggagcccgaccccacaagaacttaacagttaacaccagt |
36285073 |
T |
|
| Q |
197 |
tcaaggtggtgctcgaatccagagaagtgttccgaactcaagttgattcctgacttattcagttaacggcttggggtcaactgttccagactgggca |
293 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| | ||| |||||||||| |
|
|
| T |
36285072 |
tcaaggtggtgctcgaacccaaagaagtgttccgaactcaagttgatccctgacttattcaattaacggcttggggtcaaatattctagactgggca |
36284976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University