View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-8 (Length: 104)
Name: NF4324-Insertion-8
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 3914516 - 3914413
Alignment:
| Q |
1 |
cttacaagtcaaatagagaagtaagctttccaagctcgggagggatatgtccacttaggagattatcattcagttccctacaaaaggttgcatattaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3914516 |
cttacaagtcaaatagagaagtaagctttccaagctcgggagggatatgtccacttaggagattatcattcagttccctacaaaaggttgcatattaatg |
3914417 |
T |
|
| Q |
101 |
gctg |
104 |
Q |
| |
|
|||| |
|
|
| T |
3914416 |
gctg |
3914413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University