View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4324-Insertion-9 (Length: 119)
Name: NF4324-Insertion-9
Description: NF4324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4324-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 20184574 - 20184690
Alignment:
| Q |
2 |
aacattttgatacttgtatggtgaagctaatggaattgatagctttattgtgaacaagaaatgtggtgaaatcattttagggaagtatgattctataaaa |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
20184574 |
aacaatttgatacttgtatggtgaagctaatggaattgatagctttattgtgaacaagaaatgt-gtgaaatcattttaggaaagtatgattctataaaa |
20184672 |
T |
|
| Q |
102 |
tattttagatgaaagatt |
119 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20184673 |
tattttagatgaaagatt |
20184690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 47644385 - 47644341
Alignment:
| Q |
5 |
attttgatacttgt-atggtgaagctaatggaattgatagcttta |
48 |
Q |
| |
|
||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
47644385 |
attttgatatttgtgatggtgaagctaatggagttgatagcttta |
47644341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University