View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-1 (Length: 42)
Name: NF4325-Insertion-1
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-1 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 31; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 21979389 - 21979419
Alignment:
| Q |
12 |
gacgatgtgaaaactgatagtgaaaatcatg |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21979389 |
gacgatgtgaaaactgatagtgaaaatcatg |
21979419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University