View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-12 (Length: 72)
Name: NF4325-Insertion-12
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 29938718 - 29938650
Alignment:
| Q |
2 |
cttattactgtggtgcattatgaccccaaataaaccatgtttgtctatgtactacaggtaacttgctgga |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
29938718 |
cttattactgtggtgcattatgaccccaaataaaccatgtttg-ctatgtactagaggtaacttgctgga |
29938650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University