View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-2 (Length: 108)
Name: NF4325-Insertion-2
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-2 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 8e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 8e-43
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 24448661 - 24448759
Alignment:
| Q |
11 |
aagaatatggagtggcaaaa-tattatatggatatgctacttgtaccatgcgggtttctcattcttgttttctatcattattggttanggcatatgact |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24448661 |
aagaatatggagtggcaaaaatattatatggatatgctacttgtaccatgcgggtttctcattcttgttttctatcattattggttatggcatatgact |
24448759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 24463348 - 24463422
Alignment:
| Q |
15 |
atatggagtggcaaaa-tattatatggatatgctacttgtaccatgcgggtttctcattcttgttttctatcatt |
88 |
Q |
| |
|
|||||||||||||||| || ||||||||||| | |||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
24463348 |
atatggagtggcaaaaatactatatggatataatgtttgtaccatgtgggtttctcatccttgttttatatcatt |
24463422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University