View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-20 (Length: 124)
Name: NF4325-Insertion-20
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 7559615 - 7559738
Alignment:
| Q |
5 |
agtaatatcattttccattgcctcttgt---tattaatttttgtgtgtaaaaatgttgtgatggtaaatggaaattt-cttgtgtcaacattagttttaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
7559615 |
agtaatatcattttccactgcctcttgttgttattaatttttgtgtgtaaaaatgttgtgatggtaaatggaaatttccttgtgtctacattagttttaa |
7559714 |
T |
|
| Q |
101 |
tttgtggtatgcccaatttaagtg |
124 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
7559715 |
tttgtggcatgcccaatttaagtg |
7559738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University