View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-22 (Length: 66)
Name: NF4325-Insertion-22
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 66
Target Start/End: Complemental strand, 14104369 - 14104319
Alignment:
| Q |
14 |
gtaccagagcataaacccccagaagcagcagagagtttagcaaactcccaaag |
66 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104369 |
gtaccagagcataa--ccccagaagcagcagagagtttagcaaactcccaaag |
14104319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University