View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325-Insertion-4 (Length: 130)
Name: NF4325-Insertion-4
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 5 - 130
Target Start/End: Original strand, 26169225 - 26169350
Alignment:
| Q |
5 |
accctttggcatctgatgcgcaaaacagaaacaattttgcttcatggaggcaaaatgagcttgaaagaatgagtcctgaacaaatgctagatatctcaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26169225 |
accctttggcatctgatgcgcaaaacagaaacaattttgcttcatggaggcaaaatgagcttgaaagaatgagtcctgaacaaatgctagatatctcaag |
26169324 |
T |
|
| Q |
105 |
gtctgactactactgctggtgcatgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26169325 |
gtctgactactactgctggtgcatgg |
26169350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University