View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325_high_7 (Length: 240)
Name: NF4325_high_7
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7559396 - 7559620
Alignment:
| Q |
1 |
tgctgttgaagggttgtcatatttggcattggttgctattgttgttgtttttggtttgcagtattttcaacaaggttacattccaggtcctctccctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7559396 |
tgctgttgaagggttgtcatatttggcattggttgctattgttgttgtttttggtttgcagtattttcaacaaggttatattccaggtcctctccctgct |
7559495 |
T |
|
| Q |
101 |
gatcagtgttttggctagattttctgtttttcctttgattttcattaggataatgtgatatgagccactactgttctatcattgcacttgtggatgtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559496 |
gatcagtgttttggctagattttctgtttttcctttgattttcattaggataatgtgatatgagccactactgttctatcattgcacttgtggatgtggt |
7559595 |
T |
|
| Q |
201 |
tgctccatgcatgtatcttagtaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7559596 |
tgctccatgcatgtatcttagtaat |
7559620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University