View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4325_low_4 (Length: 315)
Name: NF4325_low_4
Description: NF4325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4325_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 28210126 - 28209812
Alignment:
| Q |
1 |
tgtgttggtgaagaattcatccaccaacagttgtcgcaaatcaggtcgtcgtgtagccttcgaagtgccttctggccacaaccaccaaagccattcctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28210126 |
tgtgttggtgaagaattcatccaccaacagttgtcgcaaatcaggtcgtcgtgtagccttcgaagtgccttctggccacaaccaccaaagccattcctct |
28210027 |
T |
 |
| Q |
101 |
ggcctcgacaacaatattgacacctccattgatgattttgacaagggacaccacaatccatgttttttggcatgttgtgcatggtcatgtcttgctattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28210026 |
ggcctcgacaacaatattgacacctccattgatgattttgacaagggacaccacaatccatgttttttagcatgttgtgcatggtcatgtcttgctattt |
28209927 |
T |
 |
| Q |
201 |
ttatatttgtcatagtttttctctttttagggatatcctatttggctttcctcaaagcagggatgcccaaagtcaatgtgaggacattcaacatgacaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209926 |
ttatatttgtcatagtttttctctttttggggatatcctatttggctttcctcaaagcagggatgcccaaagtcaatgtgaggacattcaacatgacaaa |
28209827 |
T |
 |
| Q |
301 |
gttacaagtggattc |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28209826 |
gttacaagtggattc |
28209812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University