View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4326-Insertion-15 (Length: 169)
Name: NF4326-Insertion-15
Description: NF4326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4326-Insertion-15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 6e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 3 - 169
Target Start/End: Original strand, 37015989 - 37016155
Alignment:
| Q |
3 |
gtcctcgattattcacagtaattgaaggataattgagattttcaatgttgtaaaactcaggacaaatgtaagagttgtaattaaagaactttagtaaatt |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37015989 |
gtcctcgattatacacagtaattgaaggataattgagattttcaatgttgtaaaactcaggacaaatgtaagagttgtaattaaagaactttagtaaatt |
37016088 |
T |
|
| Q |
103 |
gtgattgtgaccaaaagcacaaatgaagttcaagtaatcggttgtgcttatatcataaacgagtcct |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37016089 |
gtgattgtgaccaaaaacacaaatgaagttcaagtaatcggttgtgcttatatcataaacgagtcct |
37016155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University