View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4326-Insertion-16 (Length: 157)
Name: NF4326-Insertion-16
Description: NF4326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4326-Insertion-16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 28044293 - 28044443
Alignment:
| Q |
7 |
agaccgtgttgaatatgtagctcttctgctaactattgacgaagccatacaaagagaccaaccagtcgacttagtatttacggctgtagaggttggaaca |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28044293 |
agaccgtgttgaatatgtagctgttctgctaactattgacgaagccatacaaggagaccaaccagtcgacttggtatttacggctgtagaggttggaaca |
28044392 |
T |
 |
| Q |
107 |
gctcgtatagagaacagccgcttctgcatgtcgaagagaaattatacaata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28044393 |
gctcgtatagagaacagccgcttctgcatgtcgaagagaaattatacaata |
28044443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University