View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4326_low_6 (Length: 250)
Name: NF4326_low_6
Description: NF4326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4326_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 37957131 - 37956912
Alignment:
| Q |
14 |
gacatgggacatgaaattgttcggcttcaatgcgaagatgatccaggaaaacgcagtcgattatggaaagctgaagatgttaataacgttttaagtaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37957131 |
gacatgggacatgaaattgttcggcttcaatgcgaagatgatccaggaaaacgcagtcgattatggaaagctgacgatgttaataacgttttaagtaaga |
37957032 |
T |
 |
| Q |
114 |
ataaggtatatannnnnnnnnnnnaattacttaccgtaatggaaccacttttttcttgttttatctctaatagttcccaatgtttgcttgcttgtaggga |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
37957031 |
ataaggtatata--tatctctctcaattacttaccgtaatggaacaacttttttcttgttttatctgtaataattcccaatgtttgcttgcttgtaggga |
37956934 |
T |
 |
| Q |
214 |
acagatgcaatccggtgtatat |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37956933 |
acagatgcaatccggtgtatat |
37956912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University