View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4327-Insertion-1 (Length: 206)
Name: NF4327-Insertion-1
Description: NF4327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4327-Insertion-1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 14317427 - 14317611
Alignment:
| Q |
17 |
aagggggataaaacaatgtattatttaacagaaccgataaattcgaactcgaaaccatgcaatatttttcacnnnnnnnnnnnnnnnnnn-taatactga |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14317427 |
aagggggataaaacaat--attatttaacagaaccgataaattcgaactcgaaaccatgcaatatttttcacaaaaaagaaaaaagaaaaataatactga |
14317524 |
T |
 |
| Q |
116 |
tatcactttcaacaacttgattagtctttttcaaacaattgtttttatagaatctttcaaactatttattcttaattgattgatgaaccga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14317525 |
tatcactttcaacaacttgattagtctttttcaaacaattgtttttatagaatctttcaaac----tattcttaattgattgatgaaccga |
14317611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University