View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4327-Insertion-2 (Length: 156)
Name: NF4327-Insertion-2
Description: NF4327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4327-Insertion-2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 8e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 8e-81
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 36745673 - 36745824
Alignment:
| Q |
5 |
ataaaagactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacagacgtgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36745673 |
ataaaagactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacagacgtgg |
36745772 |
T |
 |
| Q |
105 |
ccattcaaagagatgctgagctccaagagttttggaaagaagtcgtagagat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36745773 |
ccattcaaagagatgctgagctccaagagttttggaaagaagtcgtagagat |
36745824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 6e-20; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 6e-20
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 6456435 - 6456366
Alignment:
| Q |
9 |
aagactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgt |
78 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6456435 |
aagactacccttatgctgttgatggactagaaatatgggatgctattaaggcatgggttcaagactatgt |
6456366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 6449966 - 6449899
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgt |
78 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6449966 |
gactacccttatgctgttgatggactagaaatatgggatgctattaaggcatgggtccaagactatgt |
6449899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 6331069 - 6330988
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactaca |
92 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||||||||||| ||| ||||||| |||| ||||| ||||| ||||||| |
|
|
| T |
6331069 |
gactacccttatgctgctgatggactagagatatgggatgctatcaagtcatgggttgaagaatatgtgagtttctactaca |
6330988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 6273728 - 6273640
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacaga |
99 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| || ||||||| ||||||| |||| ||||| | ||| ||||||||| |||| |
|
|
| T |
6273728 |
gactacccttatgctgctgatggattagagatatgggctgttattaagtcatgggttgaagaatatgtgaatttctactacaagtcaga |
6273640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 6320607 - 6320519
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacaga |
99 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||||||||||| ||| ||||||| |||| ||||| | ||| ||||||||| |||| |
|
|
| T |
6320607 |
gactacccttatgctgctgatggactagagatatgggatgctatcaagtcatgggttgaagaatatgtgaatttctactacaagtcaga |
6320519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 22 - 99
Target Start/End: Complemental strand, 6390145 - 6390068
Alignment:
| Q |
22 |
tgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacaga |
99 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| ||||||| | || ||||| | ||| ||||||||| |||| |
|
|
| T |
6390145 |
tgctgttgatggactagagatatgggctgctattaagtcatgggttgatgaatatgtcaatttctactacaagtcaga |
6390068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 5 - 99
Target Start/End: Complemental strand, 6287985 - 6287891
Alignment:
| Q |
5 |
ataaaagactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgttagtttgtactacaagacaga |
99 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||||||||| || |||||| ||||||| |||| ||||| ||| ||||||||| |||| |
|
|
| T |
6287985 |
ataaaagattacccttatgctgctgatggattagagatatggacagcaattaagtcatgggttgaagaatatgtgtatttctactacaagtcaga |
6287891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 28 - 66
Target Start/End: Complemental strand, 6409391 - 6409353
Alignment:
| Q |
28 |
tgatggattagagatatgggatgctattaaggcatgggt |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
6409391 |
tgatggattagagatatgggctgctattaagtcatgggt |
6409353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 14 - 75
Target Start/End: Complemental strand, 6262516 - 6262455
Alignment:
| Q |
14 |
tacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagacta |
75 |
Q |
| |
|
||||||| ||||||||||||| | || || ||||||||||||||| ||||||| ||||||| |
|
|
| T |
6262516 |
tacccttatgctgttgatggacttgacatttgggatgctattaagacatgggtacaagacta |
6262455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 7458258 - 7458203
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggt |
66 |
Q |
| |
|
||||| |||| |||| ||||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
7458258 |
gactatccttatgcttctgatggactagagatatgggctgctattaagtcatgggt |
7458203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 9606050 - 9606118
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgtt |
79 |
Q |
| |
|
|||||||||| ||| ||||||||| | ||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
9606050 |
gactacccttatgcagttgatggactcgagatatgggatgctattaagtcatgggtccaagactatgtt |
9606118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 47127152 - 47127110
Alignment:
| Q |
9 |
aagactacccttttgctgttgatggattagagatatgggatgc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
47127152 |
aagactacccttttgctgttgatggattggaaatatgggatgc |
47127110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 46
Target Start/End: Original strand, 42689403 - 42689438
Alignment:
| Q |
11 |
gactacccttttgctgttgatggattagagatatgg |
46 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42689403 |
gactacccttatgctgttgatggattagagatatgg |
42689438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 14 - 78
Target Start/End: Complemental strand, 42692442 - 42692378
Alignment:
| Q |
14 |
tacccttttgctgttgatggattagagatatgggatgctattaaggcatgggtgaaagactatgt |
78 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| ||| || ||| ||||||| |||||||||| |
|
|
| T |
42692442 |
tacccttatgctcatgatggattagagatatgggctgcaataaagacatgggttcaagactatgt |
42692378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University