View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4327-Insertion-3 (Length: 191)
Name: NF4327-Insertion-3
Description: NF4327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4327-Insertion-3 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 3e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 5 - 191
Target Start/End: Complemental strand, 39299881 - 39299695
Alignment:
| Q |
5 |
aaaatcaaccaaagttgcatgatggagatggaccgctgaaaatgcctcttccaatttttggcctaactactgataagctgaaaaggtcaattttggcttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299881 |
aaaatcaaccaaagttgcatgatggagatggaccgctgaaaatgcctcttccaatttttggcctaactactgataagctgaaaaggtcaattttggcttt |
39299782 |
T |
|
| Q |
105 |
tccgaaagcacgtgaatcaactcaactgaacactttgttgaaggctgctgatgattggttagacagtttgaatgttgtcagccatta |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299781 |
tccgaaagcacgtgaatcaactcaactgaacactttgttgaaggctgccgatgattggttagacagtttgaatgttgtcagccatta |
39299695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 41 - 181
Target Start/End: Complemental strand, 39307681 - 39307541
Alignment:
| Q |
41 |
tgaaaatgcctcttccaatttttggcctaactactgataagctgaaaaggtcaattttggcttttccgaaagcacgtgaatcaactcaactgaacacttt |
140 |
Q |
| |
|
|||| |||||| |||| ||||||||| |||||||| |||| ||| || ||||||||||| || ||||||||||| ||||| | || ||||| |||| |
|
|
| T |
39307681 |
tgaagatgcctattcctatttttggcataactacttataacctggaagggtcaattttgactcttccgaaagcagcaaaatcagatgaaatgaactcttt |
39307582 |
T |
|
| Q |
141 |
gttgaaggctgctgatgattggttagacagtttgaatgttg |
181 |
Q |
| |
|
|||||||||||| |||| ||||||| | |||||||| |||| |
|
|
| T |
39307581 |
gttgaaggctgccgatgtttggttaaagagtttgaaggttg |
39307541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 50 - 181
Target Start/End: Complemental strand, 26563536 - 26563405
Alignment:
| Q |
50 |
ctcttccaatttttggcctaactactgataagctgaaaaggtcaattttggcttttccgaaagcacgtgaatcaactcaactgaacactttgttgaaggc |
149 |
Q |
| |
|
||||||| ||||||||| |||||||| |||| |||||| ||||||||||| || ||||| || || ||| ||| | || ||||| ||| ||||||||| |
|
|
| T |
26563536 |
ctcttcctatttttggcttaactacttataacctgaaagggtcaattttgactcttccggaaacatctgattcacatgaaatgaactcttagttgaaggc |
26563437 |
T |
|
| Q |
150 |
tgctgatgattggttagacagtttgaatgttg |
181 |
Q |
| |
|
||| |||| ||||||| | |||||||| |||| |
|
|
| T |
26563436 |
tgccgatgtttggttaaagagtttgaaggttg |
26563405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University