View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4327_high_1 (Length: 321)
Name: NF4327_high_1
Description: NF4327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4327_high_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 45695140 - 45695459
Alignment:
| Q |
1 |
gtacatgacaaaatgatttgagtgaaaacctgcagataaaggaaaaagagaaggaactgcaaaatagtgtggaggtgactccaattgaaactcaaccatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45695140 |
gtacatgacaaaatgatttgagtgaaaacctgcagataaaggaaaaagagaaggaactgcaaaatagtgtggaggtgactccaattgaaacacaaccatt |
45695239 |
T |
|
| Q |
101 |
ggaatccatgaatactacagggttagtgtcttttctttcatgtataattgaattcaaaggttcccacctctctgaccgttgtgtatagtgtatattcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695240 |
ggaatccatgaatactacagggttagtgtcttttctttcatgtataattgaattcaaaggttcccacctctctgaccgttgtgtatagtgtatattcatc |
45695339 |
T |
|
| Q |
201 |
tgcatgaatttatatttgatttttatgtacctaatgtgttgtgttgatgcagatcagggtccctacaagcgaattgcaatgaagaaacagcagcacaaac |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695340 |
tgcatgaatttatatttga-ttttatgtacctaatatgttgtgttgatgcagatcagggtccctacaagcgaattgcaatgaagaaacagcagcacaaac |
45695438 |
T |
|
| Q |
301 |
aagaggtggtgccattcttcc |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45695439 |
aagaggtggtgccattcttcc |
45695459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University