View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-14 (Length: 76)
Name: NF4328-Insertion-14
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-14 |
 | |
|
| [»] scaffold0400 (1 HSPs) |
| | |
|
| [»] scaffold0365 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0400 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 5725 - 5653
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaatatgtctggagagtttattatcatcaagaagaatagaagtcaa |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
5725 |
gttttgtcaaatttccaatagtggaaggaatatgtccgcagagtttattatcatcaagaagaatagaagtcaa |
5653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 6369 - 6297
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaatatgtctggagagtttattatcatcaagaagaatagaagtcaa |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
6369 |
gttttgtcaaatttccaatagtggaaggaatatgtccgcagagtttattatcatcaagaagaatagaagtcaa |
6297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.000000005; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 15010018 - 15009988
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15010018 |
gttttgtcaaatttccaatagtggaaggaat |
15009988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 15010234 - 15010204
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15010234 |
gttttgtcaaatttccaatagtggaaggaat |
15010204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 15031116 - 15031086
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15031116 |
gttttgtcaaatttccaatagtggaaggaat |
15031086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 67
Target Start/End: Complemental strand, 15036102 - 15036044
Alignment:
| Q |
9 |
aaatttccaatagtggaaggaatatgtctggagagtttattatcatcaagaagaataga |
67 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||| |||| ||| |||||||| |
|
|
| T |
15036102 |
aaatttccaatagtggaaggaattggtccagagagtttattttcatgaaggagaataga |
15036044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 14533623 - 14533671
Alignment:
| Q |
1 |
gttttgtcaaatttccaatagtggaaggaatatgtctggagagtttatt |
49 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
14533623 |
gttttgtcaaatttccgatagtggaaggaattggtccagagagtttatt |
14533671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University