View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4328-Insertion-23 (Length: 50)

Name: NF4328-Insertion-23
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4328-Insertion-23
NF4328-Insertion-23
[»] chr7 (1 HSPs)
chr7 (1-50)||(40739170-40739219)
[»] chr2 (1 HSPs)
chr2 (1-50)||(3604394-3604443)
[»] chr6 (1 HSPs)
chr6 (1-50)||(29466375-29466424)
[»] chr4 (1 HSPs)
chr4 (1-50)||(7989116-7989165)
[»] chr1 (1 HSPs)
chr1 (1-50)||(6242111-6242160)


Alignment Details
Target: chr7 (Bit Score: 46; Significance: 3e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-18
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 40739219 - 40739170
Alignment:
1 gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 50  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||    
40739219 gttgaatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 40739170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-18
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 3604394 - 3604443
Alignment:
1 gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 50  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||    
3604394 gttgaatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 3604443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 29466424 - 29466375
Alignment:
1 gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 50  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||||    
29466424 gttgaatgacttagggatttgctgcaaaaacatgatgaaggaagaagcaa 29466375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 7989116 - 7989165
Alignment:
1 gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 50  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||    
7989116 gttgaatgatttagggatttgctgcaataacatgatgaaggaagaagcaa 7989165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 6242111 - 6242160
Alignment:
1 gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa 50  Q
    |||| |||||||||||||||||||||||||||||| ||||||||||||||    
6242111 gttgaatgatttagggatttgctgcaaaaacatgacgaaggaagaagcaa 6242160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University