View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-23 (Length: 50)
Name: NF4328-Insertion-23
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-23 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 3e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-18
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 40739219 - 40739170
Alignment:
| Q |
1 |
gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40739219 |
gttgaatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
40739170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-18
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 3604394 - 3604443
Alignment:
| Q |
1 |
gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3604394 |
gttgaatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
3604443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 29466424 - 29466375
Alignment:
| Q |
1 |
gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
50 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29466424 |
gttgaatgacttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
29466375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 7989116 - 7989165
Alignment:
| Q |
1 |
gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
50 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7989116 |
gttgaatgatttagggatttgctgcaataacatgatgaaggaagaagcaa |
7989165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 6242111 - 6242160
Alignment:
| Q |
1 |
gttggatgatttagggatttgctgcaaaaacatgatgaaggaagaagcaa |
50 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6242111 |
gttgaatgatttagggatttgctgcaaaaacatgacgaaggaagaagcaa |
6242160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University