View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-24 (Length: 88)
Name: NF4328-Insertion-24
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 5 - 88
Target Start/End: Original strand, 54895022 - 54895105
Alignment:
| Q |
5 |
ttatcaccatcagcataccacgcgatttcatcccctttattatattccctttcactgcaacaaaatcattcagtaacacacaat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895022 |
ttatcaccatcagcataccacgcgatttcatcccctttattatattccctttcactgcaacaaaatcattcagtaacacacaat |
54895105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 26859356 - 26859416
Alignment:
| Q |
5 |
ttatcaccatcagcataccacgcgatttcatcccctttattatattccctttcactgcaac |
65 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||| ||| ||| || ||||||||||||| |
|
|
| T |
26859356 |
ttatcaccatcagcataccacgcaatttcgtctcctctatgatactctctttcactgcaac |
26859416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University