View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-33 (Length: 143)
Name: NF4328-Insertion-33
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 5 - 143
Target Start/End: Original strand, 31438829 - 31438966
Alignment:
| Q |
5 |
cccccaccttaaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtgaccgactctgccggtcacatctttatcacatg |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438829 |
cccccaccttaaaa-cctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtgaccgactctgccggtcacatctttatcacatg |
31438927 |
T |
|
| Q |
105 |
caatgacgctggcgtagatttcatccatgccagcgccac |
143 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31438928 |
caatgactctggcgtagatttcatccatgccagcgccac |
31438966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University