View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-36 (Length: 154)
Name: NF4328-Insertion-36
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 7e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 7e-35
Query Start/End: Original strand, 36 - 110
Target Start/End: Complemental strand, 30951583 - 30951509
Alignment:
| Q |
36 |
agagaagaaagtatgcggcgaggtattcaaggaatttaagtaactattaatcatttaatttgagtaaataattca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30951583 |
agagaagaaagtatgcggcgaggtattcaaggaatttaagtaactattaatcatttaatttgagtaaataattca |
30951509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 30951122 - 30951070
Alignment:
| Q |
102 |
aataattcatccttacaaaactagtttgcaaagcaaagagttcatgaagttct |
154 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30951122 |
aataattcatccttacaaaagtagtttgcaaagcaaagagttcatgaagttct |
30951070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University