View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-39 (Length: 111)
Name: NF4328-Insertion-39
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-39 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 6 - 111
Target Start/End: Original strand, 1316303 - 1316408
Alignment:
| Q |
6 |
agcacgaaaacaatgatgagaactggatgaagatggaagagaggaggttgaacggtgaggatgcaggaaaacggatggcggttgcgaccggtcctacggc |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1316303 |
agcacgaatacaatgatgagaactggatgaagatggaagagaggaggttgaacggtgaggatgcaggaaaacggatggcggttgcggccggtcctacggc |
1316402 |
T |
|
| Q |
106 |
ggttcg |
111 |
Q |
| |
|
|||||| |
|
|
| T |
1316403 |
ggttcg |
1316408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University