View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4328-Insertion-4 (Length: 92)

Name: NF4328-Insertion-4
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4328-Insertion-4
NF4328-Insertion-4
[»] chr8 (1 HSPs)
chr8 (1-90)||(42329146-42329235)
[»] chr3 (1 HSPs)
chr3 (25-86)||(21313818-21313878)
[»] chr4 (1 HSPs)
chr4 (20-80)||(12205292-12205352)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 6e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 42329235 - 42329146
Alignment:
Q  1 gttatacatgcagacattatgatgctcaagttagtattttgagcaagaaagggggttaatgatagaataaatcgtaccttggaggatgta 90  Q
    |||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  42329235 gttatacatgcagacactatgatgctcaagttagtattttgaacaagaaaggaggttaatgatagaataaatcgtaccttggaggatgta 42329146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 21313818 - 21313878
Alignment:
Q  25 ctcaagttagtattttgagcaagaaagggggttaatgatagaataaatcgtaccttggagga 86  Q
    ||||||| |||||||  ||| ||||| |||||||| |||||||||| |||||||||||||||    
T  21313818 ctcaagtcagtattta-agctagaaaaggggttaaggatagaataattcgtaccttggagga 21313878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 12205352 - 12205292
Alignment:
Q  20 tgatgctcaagttagtattttgagcaagaaagggggttaatgatagaataaatcgtacctt 80  Q
    |||||||||||||||| |||| ||||| | |||| ||||| ||||||||| ||||| ||||    
T  12205352 tgatgctcaagttagtgttttaagcaatagagggtgttaaagatagaatagatcgtccctt 12205292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University