View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-46 (Length: 157)
Name: NF4328-Insertion-46
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-46 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 29956035 - 29956191
Alignment:
| Q |
1 |
atttgagggggaagttgttgatggatttggagaaattgttgcctccgccgatttctataccggatgggagattggagcatttggttgaaactactgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29956035 |
atttgagggggaagttgttgatggatttggagaaattgttgcctccgccgatttctataccggatgggagattggagcatttggttgaaactactgttac |
29956134 |
T |
|
| Q |
101 |
tgcttgggttgattcgtgcttgtatcatagttcgtcgaatcctgtttcgctttatga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29956135 |
tgcttgggttgattcgtgcttgtatcatagttcgttgaatcctgtttcgctttatga |
29956191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University