View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-51 (Length: 58)
Name: NF4328-Insertion-51
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-51 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 3e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 37164516 - 37164573
Alignment:
| Q |
1 |
accagttatctggaagccttccgcttagtctttgcgacttaacaaacatccagttgtt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37164516 |
accagttatctggaagccttccgcttagtctttgcgacttaacaaacatccagttgtt |
37164573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 37139147 - 37139196
Alignment:
| Q |
9 |
tctggaagccttccgcttagtctttgcgacttaacaaacatccagttgtt |
58 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| |||| |||||||| |
|
|
| T |
37139147 |
tctggaagccttccgctgagtctttgtgacttaacatacattcagttgtt |
37139196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University