View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328-Insertion-8 (Length: 191)
Name: NF4328-Insertion-8
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328-Insertion-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 25731564 - 25731744
Alignment:
| Q |
12 |
ccaacaaaacccagatggcatccttatggaaaccaaaa-ataaagtggacatctccttgatggaccataatcgcttcatgttccaattcttcagttatac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25731564 |
ccaacaaaacccagatggcatccttatggaaaccaaaaaataaagtggacatctccttgatggaccataatcgcttcatgttccaattcttcagttatac |
25731663 |
T |
|
| Q |
111 |
ggaaatggaacaaaatgttcaacaaggaccatggatgttcgacaatttccctctaatttggagcaaggtcccggtggggaa |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25731664 |
ggaaagggaacaaaatgttcaacaaggaccatggatgtttgacaatttccctctaatttggagcaaggtcccggtggggaa |
25731744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 85 - 191
Target Start/End: Complemental strand, 16941174 - 16941068
Alignment:
| Q |
85 |
ttcatgttccaattcttcagttatacggaaatggaacaaaatgttcaacaaggaccatggatgttcgacaatttccctctaatttggagcaaggtcccgg |
184 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||| || |||||| ||||| || ||| |||| |||||||||| || ||||||| ||| || ||| |
|
|
| T |
16941174 |
ttcatgttccaattcttcagctatgcggacatggaacgaattgttcagcaaggtccgtggctgtttgacaatttcctacttgtttggagtaagatctcgg |
16941075 |
T |
|
| Q |
185 |
tggggaa |
191 |
Q |
| |
|
||||||| |
|
|
| T |
16941074 |
tggggaa |
16941068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University