View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328_low_4 (Length: 278)
Name: NF4328_low_4
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 5680664 - 5680914
Alignment:
| Q |
8 |
cgcaatttcgtgttacaatgcaccacttgaannnnnnnaattagtggcatatgaacgttagaggcgggctaatttcattttttgtacgtctctaatttcc |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680664 |
cgcaatttcgtgttacaatgcactacttgaatttttttatttagtggcatatgaacgttagaggcgggctaatttcattttttgtacgtctctaatttcc |
5680763 |
T |
|
| Q |
108 |
gtcgttaattcaacnnnnnnnnnnnnnaatagtgattggctggtacactgatacagcaaagaaaattattaacatgaaacaggaatggaaggagtggtct |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680764 |
gtcgttaattcaacttttttttttt--aatagtgattggctcgtacactgatacagcaaagaaaattattaacatgaaacaggaatggaaggagtggtct |
5680861 |
T |
|
| Q |
208 |
ctgtgcataagagccagacaaggatctactcattgcataccactaggtcatgg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680862 |
ctgtgcataagagccagacaaggatctactcattgcataccactaggtcatgg |
5680914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 167 - 260
Target Start/End: Original strand, 5690058 - 5690152
Alignment:
| Q |
167 |
agaaaatta-ttaacatgaaacaggaatggaaggagtggtctctgtgcataagagccagacaaggatctactcattgcataccactaggtcatgg |
260 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||||||||||||||||| |||||||| |||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
5690058 |
agaaaattaattaatatgaaacagggatggaaggagtggtctctgtgcacaagagccacacaaagatatactcattgcataccacaaggtcatgg |
5690152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University