View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4328_low_6 (Length: 264)
Name: NF4328_low_6
Description: NF4328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4328_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 26969902 - 26969657
Alignment:
| Q |
1 |
ttcatttcaatcttatcttactagaaaagaaaaacacaacaaaaactaaagctacattaattcttcttcttcaaatggcatcaaaacaaccaagacacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26969902 |
ttcatttcaatcttatcttactagaaaagaaacacacaacaaaaactaaagctacattaattcttcttcttcaaatgggatcaaaacaaccaagacacgt |
26969803 |
T |
|
| Q |
101 |
tgaagaaa-tcagtgtaacaaaagaacaacatgatcaagagaagcccggtgtaattggatcagtgatgaaggctgttcaggacacctacgagaatgcaag |
199 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26969802 |
tgaagaaaatcagt-taacaaaagaacaacatgatcaagagaagcccggtgtaattggttcagtgatgaaggctgttcatgacacctacgagaatgcaag |
26969704 |
T |
|
| Q |
200 |
agaagccgtagttggcaaaagagacccaacaacagaagtccatgttt |
246 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26969703 |
agaagctgtagttggcaaaagggacccaacaacagaagtccatgttt |
26969657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University