View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-17 (Length: 110)
Name: NF4329-Insertion-17
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 2e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 32268467 - 32268575
Alignment:
| Q |
1 |
agtttaagggtaagaaattaaatattgataatgttgtttgtcatgaaattgtggtggagggctatacacagttgttagaagcacttcgaggtttaggtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268467 |
agtttaagggtaagaaattaaatattgataatgttgtttgtcatgaaattgtggtggagggctatacacagttgttagaagcacttcgaggtttaggtaa |
32268566 |
T |
|
| Q |
101 |
tgaaaacta |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
32268567 |
tgaaaacta |
32268575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University