View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-24 (Length: 90)
Name: NF4329-Insertion-24
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-24 |
 | |
|
| [»] chr1 (5 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 4e-44; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 4e-44
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 51030650 - 51030561
Alignment:
| Q |
1 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51030650 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
51030561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 4e-44
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 51063402 - 51063313
Alignment:
| Q |
1 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51063402 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
51063313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 51068971 - 51068882
Alignment:
| Q |
1 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
90 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51068971 |
gagatatagacatccttgggagcttataatgggaaatattagtaaaggaaatgtttgtgttgctggagatgctttacaccctatgacacc |
51068882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 51034928 - 51034839
Alignment:
| Q |
1 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
90 |
Q |
| |
|
|||| |||||||||||||||| || || |||||||| ||||||||| ||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
51034928 |
gagatatagacatccttgggaactcataatgggaaacattagtaaaaacaatgtttgtgttgctggagatgctttgcacccaatggcacc |
51034839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 40618010 - 40618099
Alignment:
| Q |
1 |
gagacatagacatccttgggagcttatgatgggaaatattagtaaaggcaatgtttgtgttgctggagatgctttacaccctatgacacc |
90 |
Q |
| |
|
|||| ||||| |||| |||||||| || |||||||||||||| ||||| ||||||||||||| ||| |||||||||||| ||||| |||| |
|
|
| T |
40618010 |
gagatatagaaatccatgggagctcataatgggaaatattagcaaaggaaatgtttgtgttgttggtgatgctttacactctatggcacc |
40618099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University