View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-25 (Length: 136)
Name: NF4329-Insertion-25
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-25 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 6e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 62 - 136
Target Start/End: Complemental strand, 48160904 - 48160830
Alignment:
| Q |
62 |
atttttgaaatgtcacaaacaccttcaacaaaaaatataaattgtagcagagtagaaaaacacataagtgtgggg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48160904 |
atttttgaaatgtcacaaacaccttcaacaaaaaatataaattgtagcagagtagaaaaacacataagtgtgggg |
48160830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 48161246 - 48161177
Alignment:
| Q |
1 |
aaatctgcctccactttttgtattgataatataaaagttttattattgcttctattggtgtatttttgaa |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48161246 |
aaatctgcctccactttttgtattgataatataaaagttttattattgcttctattggtgtatttttgaa |
48161177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University