View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-26 (Length: 133)
Name: NF4329-Insertion-26
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 19100249 - 19100113
Alignment:
| Q |
1 |
aactgaagctgcattgtcaaataaaaaa----ggaaagttattaagaggtggtgtaatattgtgtataagataagtttaaaaatgttgtgaacaacatac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19100249 |
aactgaagctgcattgtcaaataaaaaaaaaaggaaagttattaagaggtggtgtaatattgtgtataagataagtttaaaaatgttgtgaacaacatac |
19100150 |
T |
|
| Q |
97 |
ttctacttgttataacaagaaattgagaaagaaaaat |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19100149 |
ttctacttgttataacaagaaattgagaaagaaaaat |
19100113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University