View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-28 (Length: 143)
Name: NF4329-Insertion-28
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 24690782 - 24690640
Alignment:
| Q |
1 |
caaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggcaaagtcaaactgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690782 |
caaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggcaaagtcaaactgatgg |
24690683 |
T |
|
| Q |
101 |
tccttgctctgaagtgtgaatcagtggtatggaccagttctta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690682 |
tccttgctctgaagtgtgaatcagtggtatggaccagttctta |
24690640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 10330781 - 10330688
Alignment:
| Q |
1 |
caaagttttatgaccttgacattttcttaggtagcgagctcacttgg-ttcaaggtgatgcaccatgtaaaggttgcaccaaggcaaagtcaaa |
93 |
Q |
| |
|
||||| ||||||||||||| || || |||||| || ||||||||| |||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
10330781 |
caaagctttatgaccttgatatcgactcaggtagtgacctcacttgggttcagtgtgatgcaccatgtaaaggttgcactaaggtaaagtcaaa |
10330688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University