View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-29 (Length: 94)
Name: NF4329-Insertion-29
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-29 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 4e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 4e-44
Query Start/End: Original strand, 5 - 94
Target Start/End: Complemental strand, 37621522 - 37621433
Alignment:
| Q |
5 |
caatattaacctgctacaatggaaaatcaacaaaccaacttggtttagtaggtattacgctaccattatgtatgataaaaacaagcttgt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37621522 |
caatattaacctgctacaatggaaaatcaacaaaccaacttggtttagtaggtattacgctaccattatgtatgataaaaacaagcttgt |
37621433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University