View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-3 (Length: 131)
Name: NF4329-Insertion-3
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 33513671 - 33513538
Alignment:
| Q |
1 |
cttcttgttgtaaatcaatacaaaatcgattatgaattgaaaacaaaaaattaactaatccaattttaagtttacaaatgtttctg-----ttcttttct |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
33513671 |
cttcttgttgtaaatcaatacaaaatcgattatgaattgaaaa-acaaaattaactaatccaa-tttaagtttacaaatgtttctgttcttttcttttct |
33513574 |
T |
|
| Q |
96 |
tttcctatcatcgaatgactaacaaagtttctatgg |
131 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33513573 |
tttcctatcatggaatgactaacaaagtttctatgg |
33513538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University