View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-32 (Length: 140)
Name: NF4329-Insertion-32
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 46762930 - 46763069
Alignment:
| Q |
1 |
gaattagctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46762930 |
gaattagctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttag |
46763029 |
T |
|
| Q |
101 |
tatctttgttttttcttcaaaattcactttttaatagtga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46763030 |
tatctttgttttttcttcaaaattcactttttaatagtga |
46763069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 1083305 - 1083357
Alignment:
| Q |
6 |
agctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaa |
58 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || || ||| ||||| ||||| |
|
|
| T |
1083305 |
agctctcatggtcaaagaaaatggtcagaaaattcttcaatatcaaatgcaaa |
1083357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University