View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4329-Insertion-32 (Length: 140)

Name: NF4329-Insertion-32
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4329-Insertion-32
NF4329-Insertion-32
[»] chr1 (1 HSPs)
chr1 (1-140)||(46762930-46763069)
[»] chr5 (1 HSPs)
chr5 (6-58)||(1083305-1083357)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 46762930 - 46763069
Alignment:
1 gaattagctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46762930 gaattagctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttag 46763029  T
101 tatctttgttttttcttcaaaattcactttttaatagtga 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
46763030 tatctttgttttttcttcaaaattcactttttaatagtga 46763069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 1083305 - 1083357
Alignment:
6 agctctcatggtcaaagaaaatggttagaaagttttttaatttcaaaagcaaa 58  Q
    ||||||||||||||||||||||||| ||||| || || ||| ||||| |||||    
1083305 agctctcatggtcaaagaaaatggtcagaaaattcttcaatatcaaatgcaaa 1083357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University