View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-34 (Length: 59)
Name: NF4329-Insertion-34
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-34 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 10963181 - 10963222
Alignment:
| Q |
18 |
agctacttactagagacaacatgtgaaaaatgtgagtacgga |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10963181 |
agctagttactagagacaacatgtgaaaaatgtgagtacgga |
10963222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 10955176 - 10955214
Alignment:
| Q |
18 |
agctacttactagagacaacatgtgaaaaatgtgagtac |
56 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10955176 |
agctagttactagagacaacatgtgaaaaatgtgagtac |
10955214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University