View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-35 (Length: 201)
Name: NF4329-Insertion-35
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-35 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 58 - 201
Target Start/End: Complemental strand, 52318787 - 52318643
Alignment:
| Q |
58 |
aagatttttcatttcatattattgatactaataagaaggtaaatagatatacaaaaaattaaacgtttagacttnnnnnnngt-ccatggtctcattctt |
156 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
52318787 |
aagatctttcatttcatattattgatactaataagaaggtaaatagatatacaaaaaattaaacgtttagacttaaaaaaagtgacatggtctcattctt |
52318688 |
T |
|
| Q |
157 |
gtgctgcaagcttttggaaatgtagtgatataggagtgagtataa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318687 |
gtgctgcaagcttttggaaatgtagtgatataggagtgagtataa |
52318643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University