View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-36 (Length: 80)
Name: NF4329-Insertion-36
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-36 |
 | |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 5e-31; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 12064492 - 12064571
Alignment:
| Q |
1 |
gttatgtcttcgtcttgttcttggttggttattctggattcactagcttcgttagattttcttcttagaggcggaatcta |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||| |
|
|
| T |
12064492 |
gttatgtcttcgtcttgttcttggttggttattctggattcactagcttcattatattttcttcttagagacggaatcta |
12064571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 12051609 - 12051687
Alignment:
| Q |
2 |
ttatgtcttcgtcttgttcttggttggttattctggattcactagcttcgttagattttcttcttagaggcggaatcta |
80 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
12051609 |
ttatgtcttcatcttgttcttggttggttattctggattcaccagcttcattagattttcttcttagagacggaatcta |
12051687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 12059040 - 12059119
Alignment:
| Q |
1 |
gttatgtcttcgtcttgttcttggttggttattctggattcactagcttcgttagattttcttcttagaggcggaatcta |
80 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||||| |
|
|
| T |
12059040 |
gttatgtcttcatcttgttcttggttggttattctggattcactagtttcattatattttcttcttagagacggaatcta |
12059119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 12047371 - 12047420
Alignment:
| Q |
16 |
tgttcttggttggttattctggattcactagcttcgttagattttcttct |
65 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
12047371 |
tgttcttggtgggtatttctggattcactagcttctttagattttcttct |
12047420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University