View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-47 (Length: 222)
Name: NF4329-Insertion-47
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 53682289 - 53682451
Alignment:
| Q |
1 |
actaactccttctggtattagctttgcaaaaccaaaatcagcaactagaggcacnaaatctgaatcaagcaaaacattacttgccttgatgtctctatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682289 |
actaactccttctggtattagctttgcaaaaccaaaatcagcaactagaggcacaaaatctgaatcaagcaaaacattacttgccttgatgtctctatga |
53682388 |
T |
|
| Q |
101 |
atgatgtggggtgtgacctcatggtgcaagtacctagcaacaaaatagtcaaatgtgacaatt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53682389 |
atgatgtggggtgtgacctcatggtgcaagtacctagcaacaaaatagtcaaatgcgacaatt |
53682451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 159 - 222
Target Start/End: Original strand, 53682490 - 53682553
Alignment:
| Q |
159 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttaacgtttaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53682490 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttatcgtttaa |
53682553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 46146055 - 46146085
Alignment:
| Q |
12 |
ctggtattagctttgcaaaaccaaaatcagc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46146055 |
ctggtattagctttgcaaaaccaaaatcagc |
46146085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 135
Target Start/End: Original strand, 46146116 - 46146178
Alignment:
| Q |
73 |
aacattacttgccttgatgtctctatgaatgatgtggggtgtgacctcatggtgcaagtacct |
135 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||| || | ||||||||||||||||||| |
|
|
| T |
46146116 |
aacattgcttgcctttatgtctctatgaattatgtgaggatttgcctcatggtgcaagtacct |
46146178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University